confidexx confidexx
  • 03-03-2021
  • Mathematics
contestada

A player in a game must roll a fair number cube and flip a coin. What is the probability of a player rolling a 4 and then flipping heads?
A.1/4
B.5/12
C.1/16
D.1/12

A player in a game must roll a fair number cube and flip a coin What is the probability of a player rolling a 4 and then flipping heads A14 B512 C116 D112 class=

Respuesta :

aaliyahs97 aaliyahs97
  • 03-03-2021
I would pick D as your answer
Answer Link

Otras preguntas

how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts
what is 3/5 of 21? plz answer the question
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A guaranteed protection against vague laws is known as which of the following?
Find the measure of an exterior angle of each regular polygon: 100-gon.
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
who is the present president of liberia
For some time, the English had little interest in colonizing for what two reasons?
The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti