katrynabanks katrynabanks
  • 02-06-2021
  • Business
contestada

what is the primary purpose of a mission statement​

Respuesta :

raic7315
raic7315 raic7315
  • 02-06-2021

Answer: A mission statement is a concise explanation of the organization's reason for existence. It describes the organization's purpose and its overall intention. The mission statement supports the vision and serves to communicate purpose and direction to employees, customers, vendors and other stakeholders.

Answer Link

Otras preguntas

round 7,782 to the nearest hundred
What are some methods used by Mussolini to rise to power?
Which body tissue or organ contains the most mitochondria?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
why is it critical to your cells to be near capillaries
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?