lnash1600 lnash1600
  • 04-06-2018
  • Social Studies
contestada

Is a general framework or perspective that provides an explanation for a specific social phenomenon?

Respuesta :

ahmedishaal ahmedishaal
  • 14-06-2018

"Theory" is a general framework or perspective that provides an explanation for a specific social phenomenon.

Social theories are systems of observational proof used to ponder and decipher social phenomena. A device utilized by social researchers, social theories identify with chronicled discusses over the most legitimate and dependable philosophies for example positivism and antipositivism etc. and in addition the supremacy of either structure or agency.

Answer Link

Otras preguntas

4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
What are the factors of 6x + 24?
How to change 3 7/8 into an improper fraction
a summary about concussions
What was religion like in Shang China?
How do you write fifty-seven thousand,eighteen. In standard form
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5