Sushmitarai9132 Sushmitarai9132

03-01-2020
Social Studies

contestada

Inflation is when more money is paid for the same amount of ___________ than in a previous time period.

Respuesta :

princessesther2011 princessesther2011

04-01-2020

Answer:

Goods and services

Explanation:

Inflation is said to occur when more money is paid on the same amount of goods and services than in a previous time period

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

Make w the subject of Y-aw=2w-1

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

what does the constitution state about the interaction of the judicial branch and new laws

The cube root of the square root of the real number in is 16. what is the value of n.

Homosociality reflects children's tendency to prefer social interactions with

if the accuracy in measuring the position of a particle increases, what happens to the accuracy in measuring its velocity?

What does President Lincoln express he did not want to do?

Analyze how the stipulations of the treaty of versailles that ended world war i, along with the great depression of the 1930s, contributed to the outbreak of wo