jeamoo7550 jeamoo7550

01-04-2020
Mathematics

contestada

Carlton ran 7 3/4 miles in 52 7/10 minutes. What is the average pace per mile?

Respuesta :

Аноним Аноним

01-04-2020

Answer:

6.8 minutes per mile

Step-by-step explanation:

52.70/7.75=6.8

Answer Link

Otras preguntas

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

A 12-foot ladder leans against the side of a house with its base 3 feet from the house. use the pythagorean theorem to approximate how high the ladder reaches u

Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.

The right to a trial by jury in a criminal case is outlined in which amendment?

Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation? a. insertion mutations only occur during transcription

Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!

What are the different ways of interpreting the title of the short story was it a dream

Which absorption rate of minerals is faster plant foods or animal foods?