migueldiaz5473 migueldiaz5473

05-05-2020
History

contestada

What type of precipitation occurs when fuels are burnt and release into the air and mix the water in the clouds

Respuesta :

Rahilaattiq Rahilaattiq

05-05-2020

Answer:

Acid rain

Explanation:

Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.

Can I get briniest

Answer Link

Otras preguntas

HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why is the epa considered to be one of the most powerful bureaucracies?

a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran

why are the hindlimbs important on the frog

Business contracts or marriage licenses are found in which stage of relational development

which combination of quarks produces a neutral baryon

Secured it means a lender gives you money in exchange for what?

Which individual is correctly paired with the historical event he helped influence?

A fitness contract is a/an A. evaluation of strength, flexibility, endurance, and proper nutrition. B. written document stating an individual's