Cristaldionicio07 Cristaldionicio07
  • 04-06-2020
  • Mathematics
contestada

5. A cyclist and bike have a total mass of 102 kg and a speed of 17 m/s.calculate the kinetic energy?

Respuesta :

tarangshukla421 tarangshukla421
  • 04-06-2020

Answer:

14739

Step-by-step explanation:

1/2mv^2

1/2*105*17*17

=14739

Answer Link

Otras preguntas

what are textual aids?graphic organizers?​
What is the displacement if the bike (A) traveled home (B) and then to the tree(C)?
is -10 bigger than -4???
Um automóvel passa pelo km 40 de uma rodovia às 14 horas e pelo km 250 às 17horas. Calcule a velocidade escalar média do automóvel nesse intervalo de tempo​
Which excerpt from the poem best supports the primary meaning of Stanza 3? Year after year beheld the silent toil Year after year beheld the silent toil He left
the graph of a linear function is shown on the grid. which equation is best represented by this graph?A) y + 2 = 7/5(x + 7)B) y - 3 = 7/5 (x - 7)C) y + 2 = 5/7(
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Help with frenchhhhhhhh
Make an expression with the given table
Read the text about earthquakes and tsunamis. On what should we blame earthquakes? They are the fault of faults, of course! The cracks and gaps in the tectonic