iRoy iRoy
  • 02-10-2020
  • Spanish
contestada

Please! I don’t know much Spanish sorry

Please I dont know much Spanish sorry class=

Respuesta :

HaileyLinstrot HaileyLinstrot
  • 02-10-2020

Answer:

abuelo

nieto

esposo

padrino

casados

Answer Link

Otras preguntas

Joseph and cleoma, who made the first cajun recording, were husband and wife
Pls answer this question
Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)
Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9
A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the
Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate
help pls :) I am stuck on this chemistry question about percentage yields!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The reason why vanessa did not include sports skills activities in her program was that she: