ashlygutierrez039 ashlygutierrez039
  • 03-12-2020
  • Spanish
contestada

A cereal box says that now it contains 20% more originally it came with 20.5 unces of cereal how much cereal does the box come with now?

Respuesta :

Hotdrop
Hotdrop Hotdrop
  • 03-12-2020
The cereal box now has 22.2 ounces in it
Answer Link

Otras preguntas

(60) Points HeLp asap 5 questions
Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
what is the theoretical probability of picking a diamond from a standard deck of car
Which american colony was established in the 1660s as a haven for quakers?
Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip
6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Help plsssssssssssss
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.
What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis