KellaDaStudent836 KellaDaStudent836

04-03-2021
Mathematics

contestada

Emily made $12.50 selling lemonade for 2 hours. If Emily wants to save $100, approximately how many hours would she need to sell lemonade?

Respuesta :

anmassey603 anmassey603

04-03-2021

Answer:

she needs to work 16 hours

Answer Link

Otras preguntas

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

If you attended the us public high school the highest status crowds were probably the

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a

PLEASE I BEG YOU, HELP ME!!!!!!!! Find the rate of change of the function h(x) = 2^x on the interval 2 ≤ x ≤ 4. The rate of change is what?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u

How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?

The national competency-based credential for entry-level early childhood educators is called?

The group that receives the treatment or test stimulus or factor under study is called the

i will mark as brainiest you answer this easy question