mikey0422
mikey0422
02-12-2016
History
contestada
What kind of technology did the Bantu tribe have?
Respuesta :
MasterShadow115
MasterShadow115
02-12-2016
The Bantu Technology:
They introduced iron working in Africa, they were able to make weapons and use their weapons when they encounter enemy tribes. They also used iron works to make farm tools.
Answer Link
VER TODAS LAS RESPUESTAS ( 13+ )
Otras preguntas
Which phrase best describes the New World Order?
What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2
A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th
Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm
What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2
What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these
What is the distance between points (21, -32) and (-3, -25)?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
