taylertyrrell taylertyrrell

03-12-2021
Mathematics

contestada

Can you please help?

Can you please help class=

Respuesta :

Deathfox Deathfox

03-12-2021

Answer:

Your answer is D

Step-by-step explanation:

45 divided by 5 equals 9

Answer Link

harmonigoffigan harmonigoffigan

03-12-2021

Answer:

easy 45 dived by 9 is 5

Step-by-step explanation:

hope it helps

Answer Link

Otras preguntas

What is the value of x? x = 2 x = 3 x = 4 x = 6

Help plsssssssssssss

Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left

Who was the u.s. general fired during the korean war for trying to create another world war with china?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An important change in the american family in the nineteenth century was

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

A book with 30 pages has 21 pages with printing, 5 pages with printing and pictures, and 4 pages that are blank. What is the theoretical probability of opening