kingvinsont kingvinsont

02-03-2022
Mathematics

contestada

the price of a basketball is 24.00$ plus 8% sales tax what is the tax on this basketball in dollars and cents

Respuesta :

1055666 1055666

02-03-2022

Answer: The sales tax is $1.92

Step-by-step explanation: Multiplying 24 with 0.08 (percentages that are single digits are 0.0_) will get you $1.92

The total price will be $25.92 (24 + 1.92 = 25.92)

Answer Link

Otras preguntas

Which element is found in all organic molecules?

why do my armpits smell so bad even with deodorant

what do chromatic notes often signify in bach’s time?

frequency refers to ___ ____ we should perform certain exercises.

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

The fight or flight response that is caused by stress causes many physical symptoms a) True b) False

What kind of feelings do you have when you look at certain colors write you answer in complete paragraph the best one gets branliest

Can somebody just give me the answer plz and if you know how to do geometry drop your insta along with the answer pleaseee

Please please please help me asap!

Can someone please help me with this question? The topic is Connecting Models and Symbols. I don't know how to draw a model with the remainder for 690 divided b