calebjenkins2406 calebjenkins2406

01-04-2022
Mathematics

contestada

What is the solution to the equation

What is the solution to the equation class=

Respuesta :

flicka13blueberry flicka13blueberry

01-04-2022

Answer:

The answer to your question is C D=1

Step-by-step explanation:

i'm new to brainly but I'm also really smart in math have a nice day glad to help

Answer Link

Otras preguntas

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

Homosociality reflects children's tendency to prefer social interactions with

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How did censorship and propaganda help fortify post ww1 dictatorships?

help pls :) I am stuck on this chemistry question about percentage yields!

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

does mercury have a magnetic field

what is the absolute value of the complex number -4 — √2i

Tell what whole number you can substitute for x in the following list so the numbers are ordered from least to greatest. 2/x ,x/6, 70%