christy99 christy99
  • 01-12-2015
  • Mathematics
contestada

A quadrilateral has angles that measure 87° 69° in 104° what is the measurement of the fourth angle

Respuesta :

redcloud redcloud
  • 01-12-2015
A quadrilateral has angles that add up to 360° so x is the fourth angle in 87+69+104+x=360
260+x=360
x=100° is the fourth angle
Answer Link
loveysunshine loveysunshine
  • 01-12-2015
The sum of a quadrilaterals angles is 360 degrees. You have three of the angles so just need to add those and subtract from 360. Answer is 360-260=100 degrees
Answer Link

Otras preguntas

The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.
Question 16 (5 points)   How are the two angles related? Question 16 options: adjacent complementary supplementary vertical
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Read each verbal expression Then assign a variable and distribute
Which state ratified the constitution after congress agreed to amend the constitution to include the bill of rights
Simplify the expression completely. x squared over x to the power of 6
Which country use tax brackets as part of their tax system? canada australia south africa all of the above?
why did the church oppose the heliocentric theory
Analysis questions for b.what changes occurred in both forms of the moth over these ten years?
paul has a standard deck of cards. what is the probability he will choose a 2?