InfernoCoordiantor
InfernoCoordiantor InfernoCoordiantor
  • 04-03-2018
  • Mathematics
contestada

How does one find the equation y=ax²+bx+c when you are only provided with the coordinates of the turning point, (-6,-9)? Note: a is +1 or -1

How does one find the equation yaxbxc when you are only provided with the coordinates of the turning point 69 Note a is 1 or 1 class=

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 04-03-2018
Start with vertex form and eliminate parentheses.
.. y = a(x -h)^2 +k . . . . . . where (h, k) is the vertex
The value of "a" will be greater than zero if the parabola opens upward, as shown.

Using this form, your equation is
.. y = 1*(x +6)^2 -9
.. y = x^2 +12x +36 -9
.. y = x^2 +12x +27 . . . . . . the desired form
Ver imagen sqdancefan
Answer Link

Otras preguntas

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
How much money, in dollars, does one mole of nickels represent?
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
What kind of problems did increased urbanization cause? During time of industrial revolution
Compliant is to stubborn as excited is to
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?